Key words: CCAAT, HAP complex, transcription factor, redox system
The DNA binding activity of transcription factor HAP is regulated by cell redox.
Yao Quanhong, Yan, Yang, Liu, Hong Mengmin
Shanghai Institute of Plant Physiology, China Academy of Sciences, Shanghai 200032.
Abstract: Beer yeast CCAAT binding factor is a heteromeric complex, which contains HAP2, HAP3, HAP4 and HAP5 subunits. This factor can specifically bind to the upstream site containing CCAAT in many yeast gene promoters, and then activate transcription. By using yeast one-hybrid system, we tried to isolate the counterpart of yeast HAP5 gene from the rice cDNA-Gal4 fusion library constructed in E.coli-yeast shuttle vector pPC86. However, we found the cDNA encoding glutaredoxin (Figure 1). The results showed that the redox environment of yeast cells may be a factor regulating the binding activity of CCAAT box of HAP3 subunit (table 1). The results of HAP3 mutant in which highly conserved cysteine residues at positions 68 and 72 have been transformed into serine support the above suggestions (Table 2).
Key words: CCAAT, HAP complex, transcription factor, redox system
At the beginning of eukaryotic gene transcription, some nuclear proteins called transcription factors will combine with cis-acting elements upstream of eukaryotic gene promoter to enhance or inhibit eukaryotic gene transcription (Wolberger 1993). Some transcription factors have to undergo phosphorylation or dimerization to cause some changes in the molecular configuration of protein before they have the ability to bind to DNA (Hunter and Karin 1992). Recently, Zheng et al. (1998) reported that the binding activity of some transcription factors to DNA was regulated by the redox state in cells. For example, when the binding of Jun and Fos transcription factors to DNA containing Ap- 1 binding site was studied in vitro by gel lag test, it was observed that thioredoxin, reduced coenzyme II (NADPH) and thioredoxin reductase could significantly improve the binding ability of their heterodimers to DNA (Abate et al., 1990).
There is a cis-element whose core sequence is CCAAT upstream of the transcription start point of some eukaryotic genes, which can be in both positive and negative directions (van huiduijnen et al.1987). It is known that at least 16 genes in Saccharomyces cerevisiae all contain CCAAT elements at the upstream of 5' end. HAP complex (Pinkham and Keng 1992) is a trans-acting factor, which binds to CCAAT upstream of these genes and regulates gene transcription. It is a heterogeneous polymer composed of four protein subunits: HAP2, HAP3, HAP4 and HAP5. Both HAP2 and HAP3 contain DNA binding domains, but they have no DNA binding activity. Only when dimeric protein is formed through its subunit binding domain can a complete CCAAT box binding domain be formed (Xing et al. 1993). In addition, both in vivo and in vitro studies have confirmed that the formation of this complex functional domain requires the participation of HAP5 subunit (McNabb et al. 1995). HAP4 subunit contains activation domain, which can activate gene transcription (Foraburg and Guarente 1989). In recent years, genes encoding CCAT box binding proteins have been cloned from Schizosaccharomyces pombe, mice, rats and other organisms, and there are highly homologous domains between these CCAT binding proteins and yeast HAP transcription factor-like proteins (Van Huijsduijnen et al.1990); In higher plants, genes with high homology to the DNA domain in the HAP2 subunit have also been cloned from rape (Albani and Robert 1995).
We reported that the DNA fragment containing CCAAT box upstream of CYC 1 gene promoter in Saccharomyces cerevisiae was "fish erbium", and a cDNA clone encoding a similar protein HAP2 was screened from the rice cDNA-GAL4 expression library by yeast one-hybrid method (Yao to be published). In this study, the cDNA encoding rice HAP5-like protein was screened from the rice cDNA-GAL4 expression library in HAP5 mutant yeast cells by yeast one-hybrid method. However, the similar cDNA of HAP5 was not screened, but the cDNA encoding glutathione in rice was screened many times. This unexpected result indicates that the binding of HAP transcription factor to DNA may be regulated by redox. This paper reports the above experimental results and the mutation experiment of cysteine residue of HAP3 subunit, and discusses whether the DNA binding activity of HAP transcription factor is regulated by redox.
1 materials and methods
1. 1 Tool enzymes and chemical reagents such as restriction endonuclease are products of German Boeringer Company, and X-gal is purchased from Sigma Company. Other chemical reagents are American Sigma Company or domestic AR-grade reagents.
1.2 strain and plasmid MC8 are Escherichia coli strains with amino acid defects (Thi-, Trp-, URA-, Leu-, HIS-). Saccharomyces cerevisiae Hap 5 defective strain) hap 5δhap 5- 10(MATα, Leu 2-3,12, Ura3-52, HIS 4-5 19, Adel- 100. Escherichia coli-yeast shuttle vector PLG δ-265UP 1 contains lacZ reporter gene, URA selection marker, 2μ replication sequence and yeast CCAAT cassette. LacZ reporter gene is controlled by the basic promoter of CYC 1, and the DNA fragment containing CCAAT box is located upstream of the basic promoter of CYC 1. This element can regulate the expression of lacZ gene after binding with transcription factors. Saccharomyces cerevisiae-E.coli shuttle vector pPC86 carries tryptophan synthase gene, which was proposed by Dr. Zhu Qun. PDB20(HAP5) plasmid has LEU selection marker, and the expression of yeast HAP5 gene is controlled by ADH 1 promoter, which is used as a positive control for identifying rice-like HAP5 cDNA. PYP2 plasmid was constructed by our laboratory, containing PGK promoter and tryptophan synthase gene, and the cDNA for expression was inserted between BamH and Kpn cleavage sites after PGK promoter.
1.3 PCR primer When the cDNA of yeast pPC86 vector is inserted into the 5'- terminal Gal4 activation domain, the primer is Gal4 (5'-ggatgtttacact-3'), and the primer on the 3'- terminal ADH terminator is Tad4 (5'-ttgattggagaactgact-3'). The primers on both sides of the rice glutathione redox protein cDNA(Minakichi et al. 1994) are: the primer Gluta1(5' aaggatccatgcgccaggccaag 3') near the 5'- terminal translation initiation codon ATG, and the primer Gluta2 (5' ttgtggtactagg) near the 3'- terminal translation termination codon tag. The primers on both sides of Saccharomyces cerevisiae HAP3(Hahn et al. 1988) are: the primer hap3z1(5' aaggatcatacagCCC 3') near the 5'- end translation initiation codon ATG, and the primer hap3f1(5') near the 3'- end translation termination codon TGA. The internal mutation primers used for the mutation of Cys at the 68th position of HAP3 gene in Saccharomyces cerevisiae are: 5'-end primer hap3z 2(5'cgaaagagtcatgcaggag 3'') with mutated base, and 3'-end primer Hap3F2 (5' CTCTTGCATGGATTTCG3'). The internal mutation primers used to mutate Cys at the 72nd position of HAP3 gene in Saccharomyces cerevisiae into Ser are: 5'-end primer Hap3z3 (5' catgcaggagtcgatg3') with mutated base, and 3'-end primer Hap3F3 (5' cactgacagacctgcatg3').
1.4 rice cDNA library expressed by yeast The expressive cDNA library of rice IR36 seedlings constructed with yeast vector pPC86 was provided by Dr. Zhu Qun of Salk Institute in the United States.
Escherichia coli MC8 was grown in 1.5 medium in M9 basic medium supplemented with leucine, uracil, histidine and vitamin B 1, which was used to select pPC86 plasmid with rice cDNA. According to Sherman's method (1991), YPD, SC and yeast X-gal medium containing 2% glucose or 2% lactic acid were prepared.
1.6 preparation of competent yeast cells and plasmid transformation the lithium acetate method of Gietz et al. (1992) was selected for plasmid transformation of Saccharomyces cerevisiae. 5 ml Saccharomyces cerevisiae was cultured at 30℃ overnight until the OD600 was about 0.5, and then expanded to 50ml. After another 4 hours of growth, cells were collected by centrifugation at 5000×g for 8 minutes. Rinse with 20ml sterile water, but rinse with 10ml newly prepared LiAc solution 100mmol/L (prepared with Tris 10mmol/L and EDTA 0. 1mmol/L buffer) 1 time. After centrifugation at 7000×g for 8min, yeast cells were finally suspended in 0.5ml LiAc solution. Add 1μg plasmid DNA, 50μg salmon sperm DNA and 300μl LiAc solution containing 40% PEG3350 into 50μl yeast suspension, and keep the temperature at 30℃ for 30 minutes. Then heat shock at 42℃ for 65438 05 minutes. Yeast cells collected by centrifugation were resuspended in TE solution and coated on yeast selection medium.
1.7 DNA operation The rapid extraction of yeast DNA was carried out according to the method of Robzyk and Kassir( 1992). The DNA was manipulated according to standard molecular cloning procedures (Sambrook et al., 1989). According to the method of Dower et al. (1988), E.coli was transformed by electric shock. Double-stranded DNA containing rice cDNA positive plasmid was extracted and sequenced on ABI 377 DNA automatic sequencer. The PCR amplification conditions of primers GAL4 and TAD4 were as follows: 94℃ 40s, 42℃ 50s, 72℃ 3min, 30 rounds of * * * amplification. The PCR amplification conditions of primers Gluta 1 and Gluta2 on both sides of rice glutathione redox protein cDNA are: 94℃ for 30s, 66℃ for 45s, 72℃ for 30s, * * * 30 cycles. The site-directed mutation of HAP3 gene in yeast was performed by overlapping extension method (Ho et al. 1989). The PCR amplification reaction conditions of mutations between outer primers and between outer primers and inner primers of HAP3 are: 94℃30s, 48℃40s, 72℃30s, * * * 30 cycles.
Two results
2. Screening cDNA similar to yeast HAP5 gene in rice by1yeast one-hybrid method
The yeast one-hybrid system was originally designed by Wang He and Reed (1993). It contains two plasmids: one is a yeast expression plasmid, which is used to express the fusion protein of cDNA and GAL4 activation domain; Another plasmid connects the cis-acting element with the bacterial lacZ reporter gene with an alkaline promoter. This vector is called bait plasmid. The bait plasmid used in the yeast one-hybrid system in this experiment is PLG δ-265UP 1, which is constructed by inserting cis-acting elements containing CCAAT upstream of CYC 1 basic promoter in 178 vector. Firstly, we transformed the bait plasmid PLG δ-265UP 1 into yeast strain δ hap 5- 10, and obtained the transformant δ hap5-10 (PLG δ-265Up1) on the plate without uracil. Then 30μg of pPC86 vector containing rice cDNA was transformed into competent yeast and cultured on the medium without uracil and tryptophan. About 3× 106 transformants were obtained, and these transformants were copied to X-gal plate with nitrocellulose membrane for color reaction. As a positive control, the Δ HAP5-10 yeast strain containing hap 5 gene expression vector pDB20(HAP5) and bait plasmid PLGδ-265 up 1 turned blue after 6 hours of culture. However, the yeast strain Δ hap 5-10 (PLG Δ-265up1) containing plasmid pPC86 of rice cDNA library appeared blue colonies after 2 days. The experiment was repeated for 4 times, one * * *, and 45 blue yeast colonies were obtained.
2.2 Repeated screening of yeast positive colonies
In order to verify whether the yeast positive colonies obtained by primary screening contain cDNA clones with similar functions to HAP5, DNA was extracted from the above 45 yeast positive colonies, transformed into E.coli MC8 by electric shock, cultured on 2YT+Ap plate, and then copied to M9 medium plate without tryptophan for culture. Because pPC86 plasmid carries the marker gene encoding TRP synthase, the colony that can grow shows that it carries pPC86 plasmid. Then, plasmid DNA was extracted from E.coli which could grow on M9 medium without tryptophan, and these plasmid DNA were transformed into yeast Δ hap 5-10 (PLG Δ-265Up1) strain, and then colored on X-gal plate, from which 17 cDNA clones which could make yeast colony blue were identified.
2.3 Identification and sequencing of positive clones
Because hap5-deficient yeast can't grow on the medium containing non-fermentable carbon source, we transformed the 17 positive plasmid left after four times of yeast single hybrid screening into Δ HAP 5-10-deficient yeast for functional complementation identification. The results showed that none of these positive plasmids containing rice cDNA could make hap5 deficient yeast grow on non-fermentable carbon source medium. None of them has the function of compensating the missing HAP5 in defective yeast, so they are not cDNA clones encoding HAP5. In order to understand their structures, we used GAL4 and TAD4 as primers for PCR amplification. The amplified cDNA sequences were digested with Sau3A enzyme, and each batch of screened cDNA was classified according to the bands digested by enzyme. The results showed that among the positive cDNA screened from 17, 6 had similar enzyme bands. This cDNA clone was obtained three times in four screening libraries. We used GAL4 and TAD4 primers to directly analyze the DNA sequence of cDNA with similar enzyme bands, numbered C3. The result of figure 1 shows that its nucleotide sequence is completely the same as the reported rice glutathione redox protein cDNA (Minakichi et al. 1994). According to the nucleotide sequence of rice glutathione redox protein cDNA, we also synthesized oligonucleotide primers gluta 1 and gluta2 at both ends of the cDNA, and amplified six cDNA clones with the same band pattern by PCR. The results also confirmed that they are all cDNA encoding glutathione redox protein in rice.
Figure 1 Nucleotide sequence and deduced amino acid sequence of rice C3 cDNA clone.
Figure 1 C3 cDNA clone sequence and predicted amino acid sequence
Effect of glutathione oxidoreductase encoded by 2.4 C3 on DNA binding activity of hydroxyapatite complex
The DNA of C3 was used as the template, and gluta 1 and gluta2 with BamH and Kpn restriction sites at both ends were used as primers for PCR amplification. The PCR amplification fragment containing the complete coding region of glutaredoxin gene was digested with BamHⅰⅰ and Kpnⅰⅰ, and cloned into the corresponding restriction site after PGK promoter in yeast expression vector pYP2 to form yeast recombinant plasmid pYP3. Then pYP2, pDB20, pDB20(HAP5) and pYP3 were transformed into two yeast strains Δ hap5-10 (p178) and Δ hap5-1respectively. The above four plasmids were transformed into two yeast strains respectively. These two yeast strains are hap5 mutants, but they contain HAP4 protein with activation function and HAP2 and HAP3 proteins with binding function. Transformants were obtained on the medium without uracil and tryptophan, and eight yeast transformants were copied to the X-gal plate with nitrocellulose membrane for color reaction. Two days later, the transformant Δ hap 5-10 (pyp3+PLG Δ-265up1) showed blue color. The colony of positive control strain Δ hap 5-10 (PDB 20 (hap 5)+PLG Δ-265 up1) is dark blue. Negative control strains Δ hap 5-10 (pyp2+PLG δ-265Up1) and Δ hap 5-10 (pdb20+PLG δ-265Up/kloc-0) were found in yeast strain Δ hap 5-/kloc-0. The results showed that glutaredoxin could make HAP2, HAP3 and HAP4 express lacZ gene without HAP5.
Effect of Glutoxidoreductin encoded by table 1 C3 on lacZ gene expression on bait plasmid
Effect of Glutoxidoreductin encoded by table 1 C3 on lacZ gene expression in bait plasmid
Plasmid expression of lacZ gene
p 178 PLGδ-265 up 1
pYP2 - -
pDB20 - -
pDB20(HAP5) - ++
pYP3 - +
2.5 Effect of Cys site mutation of HAP 3 protein on DNA binding activity of HAP complex
In hap5-deficient yeast cells, glutaredoxin can make HAP2, HAP3 and HAP4 express lacZ together. Because it is known that glutaredoxin is the main component involved in regulating the redox state of cells, we speculate that its effect on HAP protein may be to regulate the reversible reaction between -SH and -S-S in HAP protein. In order to find out whether it plays this role, we mutated Cys at the 68th and 72nd positions of HAP3 gene into Ser to verify whether this conjecture is correct. Methods Using the DNA of strain Δ hap 5-10 as a template, two pairs of primers HAP3Z 1, HAP3Z2 and HAP3F 1 were used for PCR amplification. Then, using the two recovered PCR products as templates, the HAP3 gene of 68th Cys mutated into Ser was amplified by primers HAP3Z 1 and HAP3F 1. HAP3 gene mutated from Cys at position 72 to Ser was obtained by the same method. The BamHⅰⅰ and Kpnⅰⅰ products of HAP3 gene and two mutant genes were cloned into pYP2 yeast expression vector, respectively, to form plasmid pYP4 containing HAP3 gene, plasmid pYP5 containing HAP3 gene with the 68th Cys mutation as Ser and plasmid pYP6 containing HAP3 gene with the 72nd Cys mutation as Ser. Then, pYP4, pYP5 and pYP6 plasmids were transformed into yeast Δ hap 5-10 strains containing plasmids p 178 and PLG Δ-265 up1respectively, and yeast transformants were selected on the medium without uracil and tryptophan. The transformant was copied to the X-gal plate with nitrocellulose membrane for color reaction. Two days later, in the absence of glutaredoxin, the transformants of two plasmids with HAP3 mutant gene showed blue color. However, the transformant with the normal HAP3 gene plasmid did not show blue color, and the four transformants transformed into the. delta. hap5-10 (178) strain did not show blue color (Table 2). The results showed that the mutant HAP3 subunit -SH, HAP2 and HAP4 in yeast cells with mutant hap5 gene could make the lacZ genome express sexually in a one-hybrid system without redox regulation of glutathione.
Effect of Cys mutation of HAP 3 protein on lacZ gene expression on bait plasmid
Table 2 Effect of cysteine residue mutation HAP3 on lacZ gene expression in bait plasmid
Plasmid expression of lacZ gene
p 178 PLGδ-265 up 1
pYP2 - -
pYP4 - -
pYP5 - +
pYP6 - +
3 discussion
There are many intracellular redox systems, one of which is glutathione redox system, including glutathione, glutathione reductase and glutathione redox protein (Holmgren 1989). The system regulates the redox state in cells by oxidizing -SH on cysteine residue in glutathione redox protein into -S-S- bond or reversibly reducing it to -SH. This redox state also promotes the reversible oxidation or reduction of -SH or -S-S- on some functional protein molecules, causing the structural changes of protein molecules, thus affecting the activity, stability and correct folding of protein molecules (Holmgren 1989).
RAPB, a gene similar to rice HAP2, was successfully screened from rice cDNA-GAL4 expression library by yeast one-hybrid method in HAP2 yeast mutant cells. RAPB gene can supplement the yeast hap2 defect. This shows that it is effective to screen transcription factor genes with this one-hybrid system. It is reasonable that the same yeast one-hybrid system should also be able to screen similar genes of rice hap5 in the cells of yeast HAP5 mutant, but the obtained positive cDNA clone can not supplement the defect characteristics of yeast HAP5. The results of nucleotide sequence analysis of positive cDNA clones showed that the cDNA obtained from rice cDNA library encoded glutathione redox protein, instead of the expected yeast-like HAP5 protein encoded by rice. Minakichi et al. (1994) reported that the expression of glutaredoxin gene in rice was mainly concentrated in seeds, but the expression in leaves was very low. In the process of screening rice leaf expression library for four times, the glutaredoxin gene was screened for three times, which shows that this experimental result is not accidental. As for why the similar gene of HAP5 was not screened, it is because there is no HAP5-cDNA in the rice cDNA-GAL4 expression library we used, or because there is no gene with similar function in rice, which needs further study.
The functional complementation test of yeast showed that there was no obvious complementary activity between glutaredoxin gene and HAP5 gene in rice. The results of yeast one-hybrid test also showed that the activity of glutaredoxin gene in enhancing the expression of lacZ gene in rice was much lower than that of HAP5 gene. It is speculated that the function of yeast HAP5 protein may be hydrophobic interaction with HAP2 and HAP3 subunits, thus promoting the formation of a stable composite structure, which can be combined with CCAAT box (McNabb et al. 1995). If this conjecture is correct, then the function of glutaredoxin may also be to keep the HAP3 subunit in the state of -SH group, thus forming an unstable composite structure between weakly bound HAP2 and HAP3 with CCAAT box. Glutoxidoreductin promoted the DNA binding activity of HAP complex, and the experimental results of cysteine residue in HAP3 subunit mutated into serine residue were very consistent with the above speculation. That is to say, the interaction between HAP3 protein and HAP2 protein with 68-position and 72-position Cys mutation as Ser means that it has CCAAT box binding activity.
Up to now, many transcription factors have been reported, such as c-fos and c-jun(Abate et al. 1990), NFκB/Rel(Matthews et al. 1992), c-Myb(Guehmann et al. 1992) and bpv-/. The DNA binding activities of USF(Pognonec et al. 1992) and NF-Y(Nakshatri et al. 1996) are regulated by redox. Among them, NF-Y is a transcription factor cloned from human and mouse cells, which can bind to CCAAT box and is also a heteromultimeric protein. NF-YA and NF-YB are similar genes of HAP2 and HAP3 in Saccharomyces cerevisiae, respectively. They have highly homologous domains and their functions are interchangeable (Maity et al. 1992, Kim et al. 1996, Coustry et al. 1995). In addition, the positions of three cysteine residues in protein-like proteins published so far are conservative (Xing et al. 1993).
Nakshatri et al. (1996) reported that the binding activity of mouse NF-Y transcription factor to CCAAT box in vitro was regulated by redox state. Thioredoxin can enhance the binding activity of NF-Y heteroprotein with CCAT box, and when -SH group is alkylated, the binding activity of NF-Y with CCAT is destroyed. The cysteine residues of protein molecule were removed by mutation one by one, which proved that the 85th and 89th cysteines in NF-YB subunit were regulated. Thioredoxin, like glutathione redox protein, is also an intracellular redox regulatory system. Therefore, we report the discovery that glutaredoxin can bind HAP2 and HAP3 to CCAAT box without HAP5. Their results, especially the regulation of thioredoxin on the binding activity between NF-Y protein and CCAAT box, can be mutually confirmed, which is of great significance for further understanding the function of HAP5(NF-YC) subunit.
Project supported by the National Natural Science Foundation of China (39893320).
Authors: Shanghai Institute of Plant Physiology, China Academy of Sciences, Shanghai 200032.