I. Specimen Collection Types and Requirements
1, the recommended type of respiratory specimen to be collected.
The following specimens should be collected as soon as possible after onset: nasal swab, throat swab, nasal aspirate and nasal lavage. Patients with tracheal intubation should also collect tracheal aspirates. Specimens should be placed in sterile virus sampling solution, and immediately stored with ice cubes or ice rows or placed in 4℃ (refrigerator), and immediately sent to the laboratory. (Please refer to relevant documents for infection control guidelines for clinical sample collectors and laboratory testers. At the same time, fill in the sample list of suspected human infection cases of H 1N 1. (attached table 1)
2. Selection of cotton swabs
Specimens should use a swab with a synthetic fiber head (for example, polyester fiber) and an aluminum or plastic handle. Cotton swabs and wooden handles are not recommended. The specimen collection tube should contain 3 ml of virus sampling solution (containing protein stabilizer, antibiotics to prevent the growth of bacteria and fungi, and buffer solution).
3, clinical specimen preservation requirements
Store at 4℃ (no more than 4 days) or -70℃ or below. Conditional laboratory should be kept at -70℃ or below. Should not be stored at -20℃.
4, specimen packaging processing
After the specimen is sent to the laboratory, it should be treated immediately to avoid repeated freezing and thawing. The original specimen is divided into three parts, one for nucleic acid detection, one for virus separation, and the other for re-examination.
5. Transport of specimens
Suspected cases of human infection with A H 1N 1 are classified as Class A, and packed and transported with UN28 14. Fill in the Inspection Form for Suspected Human Infected with Type A H 1N 1 Infected Cases (Attached Table 2).
Second, nucleic acid detection.
The nucleic acid detection method based on PCR principle is a rapid and effective diagnostic method, which has played a great role in the emergency work of sudden infectious diseases.
1, detection of a new influenza A virus H 1N 1 based on real-time RT-PCR (primer and probe sequence designed by CDC);
On April 29th, the WHO website published the real-time RT-PCR primers and probes designed by CDC for this influenza A virus. This experiment is used to detect respiratory tract samples suspected of influenza A virus. Therefore, it is suggested to use this real-time RT-PCR method to screen influenza A virus first, and exclude seasonal influenza virus and H5N 1. The real-time RT-PCR method is shown in Annex 3 (Chinese translation version) and Annex 4 (English original version).
2. Detection of novel influenza A virus H1N1based on RT-PCR (primer sequence designed by National Influenza Center);
At present, the National Influenza Center has designed RT-PCR to detect the new influenza A virus H 1N 1. See Annex 5 for the method of RT-PCR.
Third, the isolation and identification of the virus.
Chicken embryos and/or MDCK cells can be used to isolate influenza virus. Network laboratories with corresponding conditions shall carry out virus inoculation within 24 hours after receiving the samples. See Annexes 6 and 7 for specific methods.
Four. Biosafety of influenza A virus H 1N 1 to laboratory personnel
(1) laboratory level and personal protection
1. The clinical specimens collected from patients suspected of being infected with influenza A virus H 1N 1 were diagnosed in BSL-2 laboratory. All sampling operations shall be carried out in a biological safety cabinet (BSC). Follow biosafety level 3 personal protection.
2. Virus isolation and culture of clinical specimens collected from patients suspected to be infected with influenza A virus (H 1N 1) should be carried out in BSL-3 laboratory, and the three-level personal protection of biosafety should be observed.
(2) Health monitoring
1, all the staff reported symptoms such as fever.
2. The symptoms of influenza A virus H 1N 1 include cough, sore throat, vomiting, diarrhea, headache, runny nose and muscle pain. If you feel unwell, you should report it to your superior immediately.
3. If anyone is exposed to the clinical specimens or live viruses of confirmed cases of influenza A (H 1N 1) without protection, oseltamivir or zanamivir should be considered for antiviral prevention within 7 days after exposure.
Verb (abbreviation of verb) Schedule and annex
Attached Table 1 Suspected Human Infected with A H 1N 1 Sample Table
Schedule 2 Specimens Suspected of Human Infection with Type A H 1N 1
Attachment 3: Operating Procedures for Real-time RT-PCR Detection of Influenza A H 1N 1 Influenza Virus (2009 Edition) (Chinese)
Appendix 4: Operating Procedures for Real-time RT-PCR Detection of Influenza A H 1N 1 Influenza Virus (2009 Edition) (in English)
Attachment 5: Detection of Influenza A Virus by RT-PCR
Attachment 6: Isolation Method of Influenza A Virus H 1N 1 Chicken Embryo
Attachment 7: Isolation Method of MDCK Cells of A-H 1N 1 Influenza Virus
Schedule 1
Name, sex, age, occupation ※ Current address, date of onset specimen #
Number of species specimens
(g or ml) acquisition
Date remarks ※ Option: refer to the infectious disease report card.
# Options: A nasopharyngeal swab, B nasopharyngeal aspirate, C nasal lavage fluid, D nasal aspirate, E tracheal aspirate, F other (if other, please indicate in the form).
Acquisition personnel: acquisition unit (seal):
Schedule 2
Name, sex, age, occupation, current address, onset date #
Number of samples *
(g or ml) acquisition
Date remarks ※ Option: refer to the infectious disease report card.
# Options: A nasopharyngeal swab, B nasopharyngeal aspirate, C nasal lavage fluid, D nasal aspirate, E tracheal aspirate, F other (if other, please indicate in the form).
* Specimen quantity: If there are multiple packages for the same specimen, please indicate.
Fill in the Form: Sample Delivery Time: Unit (Seal):
Annex 3
Operating procedures for real-time RT-PCR detection of influenza A (H 1N 1).
Chinese translation (please also refer to the English original)
Please note: Please refer to the system setup instructions provided by the kit supplier. The system in this regulation is for reference only.
Operating Rules for Real-time RTPCR Detection of Swine Influenza in CDC (2009 Edition)
The ownership of this program belongs to the Center for Disease Control and authorizes the public health laboratory to use it in an emergency. These Provisions shall not be used for commercial activities or profit-making purposes.
I. Overview
(A) the premise
This program is based on the basic mastery of rRT-PCR method.
(2) experimental principle
The scheme of real-time fluorescence quantitative RTPCR for detecting swine flu is to use a set of oligonucleotide primers and TaqMan &: Probe, qualitative detection and identification of swine influenza virus in reg respiratory tract samples or in vitro cultures. InfA primers and probes are designed to detect influenza A virus, swInfA primers and probes can specifically detect all swine influenza A viruses, and swH 1 primers and probes can specifically detect swine influenza H 1 subtype viruses. This experiment is used to detect the respiratory tract samples of suspected swine flu cases with positive influenza A. ..
(3) Conditions of use
One-step quantitative RT-PCR 96-well plate thermal cycle system.
(4) Biosafety requirements
Sample processing should be completed in the corresponding biosafety laboratory.
(5) Sample requirements
1, respiratory tract sample
Bronchoalveolar lavage fluid, tracheal aspirate, sputum, nasopharyngeal or oropharyngeal lavage fluid or swab. The top of the swab used in the swab sample should be made of artificial materials (such as polyester or polyester), and the handle should be made of aluminum or plastic. It is not recommended to use cotton swabs with cotton heads and wooden handles. Sampling with calcium alginate swab is not advisable.
2. Exclusion criteria
1) samples not stored at 2-4 C (≤ 4 days) or-70 C or below.
2) Other unsuitable samples not listed above.
(6) nucleic acid extraction
The amplification efficiency of RT-PCR depends on the quality and quantity of sample template RNA. RNA extraction operation should be used in sample experiment after the purity of nucleic acid is qualified. Commercial operating procedures include QIAAMP &；; Reg virus RNA extraction kit; Reg small kit (QIAGEN Company), Roche MagNA Pure Compact RNA isolation kit, MagNA Pure LC RNA isolation kit II and Roche MagNA total nucleic acid purification kit can extract high-purity RNA under the recommended operating procedures.
(7) Disclaimer: The name of the manufacturer mentioned is only an example, which does not mean that it has been approved by CDC.
Second, the experimental materials
(1) reagent
1, one-step fluorescence quantitative RT-PCR probe kit;
2. Molecular sterile distilled water (excluding RNase and DNase);
3. Forward and reverse primers (40μ m);
4. Double labeled probe (10 μ m);
5. Positive control.
(2) Supply
1, laboratory marker;
2. Microcentrifuge tube grid, 96-hole 0.2ml PCR reaction tube;
3. 20μl and 200μl adjustable pipettes and filter heads;
4.0.2ml PCR reaction tube plate;
5. Photoreactive cover plate;
6. Sterile, nuclease-free 1.5 ml microcentrifuge tube;
7. Disposable dust-free gloves.
(3) Instruments and equipment
1. Micro centrifuge;
2. Eddy current oscillator;
3. Real-time fluorescence quantitative PCR detection system, including 96-hole thermal cycle reaction plate.
Third, the operating procedures
(1) preparatory work
1. Avoid sample contamination.
Due to the sensitivity of fluorescence 5' nuclease determination, special attention should be paid to the generation of false positives. The following pollution prevention methods are recommended:
1) experimental preparation and nucleic acid extraction use independent regions;
2) Special equipment (such as pipettes and microcentrifuges) and consumables (such as microcentrifuge tubes and suction heads) are used for experiment preparation and nucleic acid extraction;
3) Wear clean work clothes and use new disposable powder-free gloves after the experiment;
4) Replace gloves between different sample operations and in case of suspected contamination;
5) The covers of reagents and reaction tubes should be closed as much as possible.
2, instrument preparation
Worktables, pipettes and centrifuges must be cleaned and purified with cleaning agents, such as 5% bleach, "DNAzap" or "RNase away &；; Reg "to reduce the risk of cross-contamination of nucleic acids.
3, reagent preparation
Note: During the test, all reagents should be stored on the ice shelf at low temperature.
1) primers and probes
(1) Melt the packaged frozen primer and probe (the melted probe can be stored in the dark at 2-8℃ for up to 3 months, so don't freeze and thaw the probe repeatedly);
(2) vortex oscillation primers and probes;
(3) The primer and probe are instantaneously centrifuged and then placed on an ice shelf.
2) reagents for 2) real-time RT-PCR
(1) Put Master Mix and enzyme on the ice shelf;
(2) melting 2× reaction mixture; ;
(3) mixing 2× reaction mixture; Upside down;
(4) Immediately centrifuge the reaction mixture and enzyme twice as much, and put it on an ice shelf.
4. detect every step of RT-PCR.
1) RNA extracts were detected by primers and probes: INFA, SWF Lua, SWE H 1 (SWH 1) and RNaseP (RP). RNaseP primers and probes take human RNaseP gene as the target gene, so they can be used as the internal positive control of human nucleic acid.
2) Template-free control (NTC) and positive template control (PTC) were established for all primers and probes included in each process.
3) Human sample quality control (HSC) provides secondary negative quality control to confirm the integrity of nucleic acid extraction process and reagents.
Step 5 Establish a reaction
The reaction detection mixture was thoroughly mixed and then added to a 96-well plate. Then, water and the extracted nucleic acid or positive template control (PTC) are added to the appropriate experimental reaction and control.
1) label one 1.5ml microcentrifuge tube for each primer and probe;
2) Determine the reaction number (n) of each established reaction. Considering the reaction and adsorption errors of NTC, PTC and HSC, it is necessary to prepare excessive reaction mixture. Details are as follows:
(1) If the sample number (n) ranges from 1 to 14, then n = n+1;
(2) If the number of samples (n) is greater than 15, including the control, then N=n+2.
3) Master mixture: Calculate the amount of each reagent added to each primer/probe reaction mixture. The calculation is as follows:
* Please refer to the system setup instructions provided by the package supplier.
4) After adding water, blowing air up and down to make the reaction mixture evenly mixed without vortex oscillation.
5) centrifuge for 5s to make the mixture gather at the bottom of the test tube, and then put the test tube on an ice shelf;
6) Prepare a plate-shaped reaction tube or a 96-well plate and put it on an ice shelf;
7) Suck 20μl into each hole of each main mixture, and proceed in sequence in each row, as shown in the following figure:
Examples of experimental establishment:
Examples of experimental samples:
Note: Before adding any samples, negative template control (NTC)( 1 column) should be added to test the contamination in the main mixture. HSC should be added after the sample to be tested (1 1 column) to check the cross contamination during sample preparation or addition. Positive template control (PTC) should be added after all samples and negative template control (NTC).
8) Before moving the culture plate to the nucleic acid processing area, NTC reaction was carried out in the first column of the reaction plate in the experimental setting area. As mentioned above.
9) Suck 5μl nuclease-free water into NTC hole and cover the NTC hole.
10) and move it to the nucleic acid treatment area.
1 1) Vortex the test tube containing the sample for 5s, and centrifuge it instantaneously for 5s;
12) Put the extracted nucleic acid sample on an ice shelf;
13) As mentioned above, samples should be added in columns, and 5μl of the first sample should be sucked into all holes marked with this sample (as shown in the above table, sample "S 1"). The gun head needs to be replaced between different samples.
14) The hole after sample addition should be covered, which is beneficial to prevent cross-contamination of samples and facilitate the operator to record the specific process of sample addition;
15) In order to avoid cross contamination, change gloves when necessary;
16) Repeat step13-15 for the remaining samples;
17) Add 5μl HSC sample (1 1 column) to the HSC hole. Cover the HSC hole.
18) Finally, add 5μl of positive template control RNA to all PTC wells and cover the PTC wells.
19) If an 8-tube strip plate is used, each strip should be labeled to indicate the position of each sample (don't label the top of the reaction tube! )。 Instantly centrifuge the tube 10- 15s, and then put it on the ice shelf. If a culture plate is used, centrifuge 500 g for 30 s at 4℃ and put it on an ice shelf.
6.RT-PCR amplification conditions
The reaction system was 25ul, and the reaction conditions were as follows:
Note: The fluorescence signal (FAM) should be collected in steps of 55 degrees.
* Please refer to the instructions provided by the kit supplier for specific amplification conditions.
7. Interpretation/inspection
1) The fluorescence growth curve obtained in the negative control reaction of probe/primer should not exceed the threshold line. If the negative reaction of one or more primers and probes is false positive, the sample may have been contaminated. Then the whole experiment process is invalid, and the experiment is repeated in strict accordance with the step rules.
2) Before 37 cycles, the RP response curves of all clinical samples should exceed the threshold line, which indicates that sufficient RNA has been amplified from human RNase P gene and the sample quality is qualified. However, due to the small number of cells in the initial clinical samples, some samples may not have positive results. At the same time, samples obtained from animals/birds or through cell culture often have no or weak results in RP reaction. If RNase P is negative in all clinical samples, it means:
(1) improper nucleic acid extraction from clinical materials leads to RNA loss or residual contamination of RT-PCR inhibitors in clinical samples;
(2) There are not enough human cells for testing;
(3) Improper formulation and implementation of methods;
(4) reagents and instruments.
In HSC group, the fluorescence growth curves of InfA, swFluA and swH 1 probe should not exceed the threshold line within 40 cycles. If the growth curve of any influenza-specific probe exceeds the threshold line, there is the following explanation:
(1) may be due to the contamination of RNA extraction reagents. Make sure that the RNA extraction reagent is correct before the experiment.
(2) Cross contamination occurs during (2)RNA extraction or sample addition. Repeat the experiment in strict accordance with the requirements of the operating procedures.
(3) Before 40 cycles, INFA, SWNFA, SWH 1 and RP of PTC reaction should be positive. If the expected positive result is not produced, it will be considered invalid, and the experiment should be repeated in strict accordance with the operating procedures. Determine the failure reason of PTC reaction, modify and record the error reason and change scheme. PTC reagents that do not produce the expected results are no longer used.
(4) When all the quality control products meet the requirements, if the growth curve of InfA reaction crosses the threshold line within 40 cycles, the sample is considered as positive for influenza A virus. If influenza A virus is positive, Univ SW and/or SW H 1 may also be positive. If the reverse growth curve of InfA and specific subtype reactions (swInfA and swH 1) crosses the threshold line within 40 cycles, the sample is regarded as A/H 1 positive for swine influenza virus. If the sample is only positive for InfA and one subtype, or only positive for InfA, please contact CDC for further guidance.
(5) On the premise that all quality control products meet the requirements, if all InfA reactions of the sample to be tested are negative within 40 cycles, the sample will be regarded as negative.
8. Restrictions and regulations
1) Before the actual operation, the experimenters should be trained in operating procedures and test result analysis, and then they can conduct experiments after mastering them skillfully.
2) When the sample size is insufficient, it may produce false negative results, which may be caused by improper collection, transportation or treatment.
3) If there are too many DNA/RNA templates in the reaction, false negatives may also occur. If the RP reaction of the sample is inhibited, the extracted RNA can be diluted 2 times or more (for example, 1: 10 or 1: 100) to repeat the experiment.
9. Comments
Primers and probes are shown in English version P7.
Annex 4
Operating rules for real-time RT-PCR detection and identification of influenza A virus H 1N 1.
(English version)
Annex 5
Detection of novel influenza A virus H 1N 1
I. Purpose
Detect the collected suspicious case samples, screen influenza A virus H 1N 1, and exclude seasonal influenza virus H 1N 1.
II. Primer NIC Primer Name Base Composition Note on the size of target fragment Fluafula-m-F 30 ttctaaccgagggtcgaacg 235 BP universal detection primer Flua-m-R 264 aaaggcgtctacgccagh1Hah65438+0f11 47 aagagcacatatgccat 527bp H 1N 1 universal primer h1r1r6543868actggactctgctggaac327bp human seasonal influenza virus h1n1subtype detection primer h/ kloc-0/HA r 1094 aatgaaccggcaatgtcc SWH 1HA- 1SW-h 1F。 Primers SW-H1N1R 920 aggctgtttttatrgcacactgg153 BP influenza A virus. The AGC G is about 80bp, which is consistent with the RnaseP primer in real-time PCR. CGG CTG TCT CCA CAA GT III. Materials and instruments.
1, RNA extraction kit qiagen rneasy mini kit (catalog number 74 104)
2.β- mercaptoethanol (Sigma β-mercaptoethanol batch number 062k0 1 15)
3.70% ethanol
4. RT-PCR kit: QIAGEN one-step RT-PCR kit (catalog number 2 102 12).
5. RNase inhibitor (Promega catalog number N2 1 1 1)
6. Primer detection
7.Axygen 1.5mL centrifuge tube, article number: MCT-150-C.
8.Axygen 0.2mL PCR tube, article number: PCR-02-C.
9. Axygen 10 microliter, 100 microliter, 200 microliter and 1000 microliter needles with filter elements.
10,10μ l,100μ l, 200μ l,1000μ l sampler.
Centrifuge 1 1, speed 14K adjustable;
12, vortex mixer:
13, biosafety cabinet: Class II biosafety cabinet.
14, PCR instrument:
15, agarose: biowest agarose distributed by Genetech (Shanghai) Co., Ltd., batch number 10 1685.
16, nucleic acid dye:
17. Electrophoresis solution: 5×TBE electrophoresis buffer catalog number 90090327 18. Electrophoresis tank and electrophoresis equipment.
Fourth, the experimental steps
(1) RNA extraction
1. Sub-package the RLT solution according to the number of samples: take the RLT solution out of the kit and sub-package it in 1.5mL centrifugal tubes, each tube is 500μL (operated in the system preparation area).
2. Add 100μL sampling liquid (nasal swab, throat swab, pleural effusion, etc.). ) or virus culture (chicken embryo allantoic fluid or cell culture fluid) is injected into the RLT liquid tube in the biosafety cabinet and mixed thoroughly.
3. Add 5μL β- mercaptoethanol to each tube, and then add 600μL 70% ethanol in turn after mixing, and mix thoroughly.
4. Take out 2mL collection tube with filter column from the kit, open the package and mark it. Add 600μL of the mixed solution in step (3) to the filter column, centrifuge at 65438±02000 rpm for 65438±05s, and discard the centrifuge in the collection tube.
5. Put the filter column back on the collecting tube, suck all the remaining mixed liquid in step (3) into the filter column at the speed of12000rpm, centrifuge for 15s, and discard the centrifugal liquid.
6. Add 700μ l of washbuffer RW1solution, 12000rpm, and centrifuge 15s to the filter column.
7. Take out a clean 2mL collection tube from QIAGEN RNeasy Mini kit, move the centrifugal filter column to a new collection tube, and add 500μL washing buffer RPE solution, 12000rpm, and centrifuge 15s.
8. Discard the centrifugal liquid in the collection tube, then add 500μL of washing buffer RPE liquid into the filter column and centrifuge at 13000~ 14000rpm for 2 minutes.
9. Move the filter column to a clean 1.5mL eppendorf tube, add 30~50μL water without ribonuclease to the filter column, and let it stand at room temperature for 1~3min.
10, 1 2000rpm, centrifuge1min, collect the centrifuge liquid, which is the extracted virus RNA, and do the experiment immediately or store it below -20℃.
Note: Add 44 ml of absolute ethanol before using RPE buffer.
(2) Preparation of reaction system
1, experimental design:
Detection of sample RNA
Quality control parameters:
Negative control: sterile water (when RNA is extracted from the sample, sterile water is extracted at the same time as the sample. )
Positive control: known viral RNA
2. Preparation of 2.PCR reaction system (preparation of reaction solution in system preparation area)
1) Add reagents according to the following table:
Component volume (μL) of PCR reaction system without RNase water.
5×RT-PCR buffer 1 1.9×n
5× n10 mm dntpmix/kloc-0 /× nenzyme mix/kloc-0 /× nrnase inhibitor 0. 1× nUpstream primer 0.5× nDownstream primer 0.5× nTotal 20× Determine the number of reactions for each established reaction (n= the number of PCR tubes to be conducted. Considering negative template-free control, positive control and error, it is necessary to prepare excessive reaction mixture. Details are as follows:
(1) If the sample number (n) ranges from 1 to 14, then n = n+1;
(2) If the number of samples (n) is greater than 15, including the control, then N=n+2.
2) Mix the above reaction solutions evenly, subpackage them in 0.2mL PCR tubes, each tube is 20μL, and label them respectively.
3) Add RNA template (in nucleic acid extraction area)
Add the template to the above individually packaged PCR tubule. First, add negative control tubes (5μL sterile water), then add sample RNA (5μL per tube), and finally add positive control RNA (5μL per tube).
3.RT-PCR reaction
Mix the reaction tube with the template evenly, centrifuge for a short time, and put it into a PCR instrument for RT-PCR.
The amplification procedure is as follows: temperature (C), time cycle number 60℃1min1min50℃ 30min95℃15min94℃ 30s3552℃ 30s72℃1min72℃ 7min65438.
Preparation of 1)2.0% agarose gel: Weigh 2.0g agarose, pour it into a heat-resistant glass bottle, add 100 ml electrophoresis solution (1× TBE), stir gently, and heat until the agarose is completely melted. When the temperature of agarose gel drops to about 50 ~ 60℃, add nucleic acid dye and gently stir (no bubbles). When the glue temperature drops to about 50℃, pour it into the glue making board and insert the electrophoresis comb. After the glue is completely solidified (about 30 ~ 60 min), pull out the comb.
2) Put the prepared electrophoresis gel into an electrophoresis tank (the end with comb holes is at the cathode), and pour electrophoresis solution (1×TBE) to soak the gel surface.
3) Take 10μL PCR products respectively, add 2μL loading buffer (6× loading buffer), mix well, and then add them into electrophoresis gel wells (first add 5 μ l label (DL-2000), then add sample PCR products in turn, then add negative control products, and finally add positive control products).
4) The electrophoresis voltage is 100V, and the results will be seen after about 30 ~ 40 min.
5) Put the electrophoresis gel into the gel imaging system to observe the results and take photos.
5, the result judgment
When the system is established, that is, when the reference of yin and yang is normal, the meanings of each primer are as follows: PCR primer sample 1 sample 2, sample 3, sample 4, sample 5, sample 6 flua _++/-h1-huh1ha _++/-SWH.
Non-H 1N 1 subtype human seasonal H 1N 1 subtype swine H 1N 1 subtype influenza virus.
Send it to the National Influenza Center for review. The sample sent to the National Influenza Center for testing is not of human origin/there are few cells in the sample/there is something wrong with the experiment or instrument.